manucharova_n_a_molekulyarnobiologicheskie_aspekty_issledova


Чтобы посмотреть этот PDF файл с форматированием и разметкой, скачайте его и откройте на своем компьютере.
1




Н.А. Манучарова



Молекулярно
-
биологические аспекты исследований

в
экологии и микробиологии






УЧЕБНОЕ ПОСОБИЕ






МОСКВА



20
10
МОСКОВСКИЙ ГОСУДА№СТВЕННЫЙ УНИВЕ№СИТЕТ

имени М.В. ЛОМ
ОНОСОВА


ФАКУЛЬТЕТ ПОЧВОВЕДЕНИЯ


КАФЕД№А БИОЛОГИИ ПОЧВ





Н.А. Манучарова




Молекулярно
-
биологические аспекты исследований

в экологии и микробиологии


Допущено Учебно
-
методическим объединением

по классическому университетскому образованию

(отделе
ние почвоведения) в качестве

учебного пособия по специальности

013000


©
Почвоведение
ª




©У
НИВЕ№СИТЕТ И ШКОЛА
ª


20
10




3

УДК 631.46

ББК


Ответственный редактор

доктор биологических наук, профессор,
чл.
-
корр.

№АН
И.Ю.Чернов


Учебное пособие издано при финанс
овой поддержке

Гранта №ФФИ №
0
8
0
4
01233


№екомендовано

Учебно
-
методической комиссией факультета почвоведения
МГУ имени М.В.Ломоносова в качестве учебного пособия для студентов,
обучающихся по специальности 013000 (020701) и направлению 510700
(020700) ©Поч
воведениеª.





Манучарова Н.А.

Молекулярно
-
биологические аспекты исследований в экологии и
микробиологии
:
Учебное пособие.




М. Издательство

МГУ, 20
10
.


с.
4
7



Для студентов, аспирантов, преподавателей и научных работников,
специализирующихся в
области почвенной микробиологии, агрохимии,
почвоведении, экологии.





4

Содержание



Введение
……………………………………………………………………..

5

Глава 1.
Выделение ДНК (РНК) из биологического
материала
………………………………
………………………..
………
….
6


1.1.
Выделение ДНК из почвенных образ
цов
…………………………

9


1.2.
В
ыделение ДНК из бактериальной биомассы
…………………..
1
0

Глава 2
.

Амплификация фрагментов генетического
материала
………………………………………………………………………
1
2

2.1.
Полимер
а
зная цепн
а
я ре
а
кция

(
ПЦР
)
……………………………..
1
3

2.2.
Стадии полимеразной цепной реакции


1
5

2.3.
Праймеры

1
7

2.4.
Разновидности ПЦР


19

2.5.
Факторы, влияющие на точность мо
лекулярных

исследований
…………………………………………………………………..
2
1

2.6.
Амплификация фрагментов
гена 16
S

рРНК
…………………….
2
4

2.7.
Методы определения нали
чия хитиназного гена группы А


у чистых культур микроорганизмов и в почве
…………………
2
6

Глава
3
.

Анализ продуктов а
мплификации

………………………

2
7

3.1.
Электрофорез
……………………………………………………………..
2
7

3.1.1.
Приготовление агарозного геля

………………………………..

29

3.1.2.
Приготовление полиакриамидного геля

……………………….

29


Глава 4
.

Оценка мониторинга микробных сообществ
методами, основанными н
а использовании ПЦР

……………..

3
1


Глава 5. Клонирование
………………………………………………….

35


Литература
…………………………………………………………………..

42



5

В
ведение

Молекулярная экология


это новая стратегия изучения разнообразия организмов в
природных сообществах.

И
сследования в этом
направлении призваны ответит
ь на
следующие основные вопросы
: 1. Какова структура сообщества в исследуемом
ареале (участок суши, пресноводный бассейн
,

участок морской или океанической
акватории и т.п.). 2. Меняется ли структура сообщества в исследуемом ареа
ле под
воздействием тех или иных причин и каким образом. 3. Меняются ли
взаимоотношения между участниками сообщества в процессе изменения структуры
сообщества, в чем состоят эти изменения. 4. Как происходит обмен генетическим
материалом между участниками э
косистемы, имеет ли место так называемый
горизонтальный перенос генетической информации. Ответ на последний вопрос
особенно важен в связи с широким распространением в природных сообществах
генетически модифицированных микроорганизмов.


В последние годы
систематика и филогения организмов строятся все чаще на
различиях в структуре генома и переходят в область геносистематики,
основанной на новейших достижениях молекулярной биологии.
Появление и
усовершенствование различных методов молекулярной биологии
(
ги
бридизационного анализа, секвенирования,
денатурирующего градиентного
гель электрофореза,
молекулярного клонирования и полимеразной цепной
реакции
)

привели к созданию методологии молекулярной экологии.
Использование описываемых в пособии молекулярно
-
биоло
гических методов
дает возможность расширить имеющиеся представления о микробном
разнообразии в природных субстратах.

Стало возможным изучение
биоразнообразия на основании анализа отдельных элементов их генетического
материала без выделения отдельных микроо
рганизмов в чистую культуру
(
Нетрусов и др., 2004
).
В связи с этим возможным становится учет, так
называемых, ©некультивируемых формª бактерий


не способных расти в
лабораторных условиях, составляющих подавляющую часть микробных
сообществ.



6

Масштабы объект
ов молекулярной биологии могут быть самые разные: от слона до
невидимого невооруженным глазом организма
, при этом
о
бъект
ом

молекулярных
методов анализа

является
молекула ДНК или №НК
.
Следовательно
,

и
сходным
этапом всех молекулярно
-
генетических методов явля
ется получение образцов
ДНК. Источником геномной ДНК (матрицы) могут быть субстраты
различной
природы
(растворы: плазма крови, речная или морская

вода, суспензии (почва),

клет
очная биомасса
).
Возможность проведения молекулярно
-
генетического
анализа с небол
ьшим количеством легкодоступного биологического материала
является методическим преимуществом методов данной группы.
Выделенная ДНК
одинаково пригодна для проведения различных исследований и может долго
сохраняться в замороженном виде.

Глава 1.

Выделение
ДНК (РНК)

из биологического материала

На данной стадии проведения анализа проба подвергается специальной
обработке, в результате которой происходит лизис клеточного материала,
удаление белковых и полисахаридных фракций, и получение раствора ДНК или
№НК, св
ободной от ингибиторов и готовой для дальнейшей амплификации.
Выбор методики выделения ДНК(№НК) в основном определяется характером
обрабатываемого материала.

В случае выделения генетического материала из растворов (плазмы крови,
водные образцы) проблема вы
деления нуклеиновых кислот решается проще:
клетки выделяют фильтрованием (или центрифугированием) и затем лизируют
с последующей экстракцией ДНК фенолом и хлороформом
.



Сложнее обстоит дело с выделением ДНК из природных суспензий типа
почвенной. Проблема
состоит в том, что никогда нельзя сказать, насколько
полно извлечены нуклеиновые кислоты из образца окружающей среды.
Культивирование клеток не дает представления об этом, поскольку в культуру
удается перевести по разным оценкам лишь от 1 до 20% микроорган
измов,


7

находящихся в исследуемом образце. Существенная доля организмов,
находящихся в почве, относится к некультивируемым формам.

Широко используются два изначально различных подхода

выделения ДНК

прямой лизис in situ

и
извлечение клеток с последующим лиз
исом

(
van

Elsas

J
.
D
.

all
, 1998).

Прямая экстракция ДНК из почв применима к различным почвам и дает
выход ДНК чаще всего в диапазоне от 10 до 30 мкг/г почвы. Следует, однако,
иметь в виду, что ДНК может адсорбироваться на почвенных частицах, что
приводит

к снижению количества выделяемой ДНК

(
Frostergard


al
, 1999
)
.
При этом выход колеблется в зависимости от состава почвы

(содержания
илистой фракции)
, так что необходимо подбирать условия эксперимента для
данной конкретной почвы. Еще одной проблемой, возн
икающей при
непосредственном выделении ДНК из почвенного образца, является большое
количество гуминовых кислот, загрязняющих получаемые препараты ДНК

(
Tebbe


al
, 1993
)
.


Методы так называемой "прямой экстракции" нуклеинового материала из
образцов подверг
ают
клетки
непосредственному разрушению

-

комбинацией
обычных процедур: замораживание
-
оттаивание, детергентный лизис,
механическое (ударное) разрушение. При этом разрушаются и эндоспоры.
Мелкие клетки более устойчивы к лизису. Считается, что такого рода
об
работки приводят к извлечению
до
96% нуклеинового материала, а
длительные многократные обработки позволяют извлекать 99,8% этого
материала. Однако всегда остается открытым вопрос, насколько эти оценки
близки к истине, поскольку содержание нуклеотидного мат
ериала в образце
неизвестно
.

Непрямая экстракция ДНК с предварительным извлечением клеток весьма
существенно зависит от способа экстракции микробных клеток из почвы.
Сущность процедуры сводится к отделению клеток от частиц почвы с


8

последующим разрушением к
леток путем обработки шариками, детергентом,
экстракцией фенолом, фенол
-
хлороформной смесью и далее
-

стандартными
приемами очистки нуклеиновых кислот и разделения на фракции №НК и ДНК.
Выход ДНК и р№НК составля
ет

15
-
30 и 0,25
-
1,0 мкг/г почвы
,

соответствен
но.

Получение генетического материала всегда включает в себя стадии
чередования охлаждения и нагревания исследуемого
образца

с последующим
центрифугированием. Такая особенность методики связана с лучшей
десорбцией клеток с поверхности почвенных частиц при

смене температур.

Для отделения бактериальных клеток от элементов почвы и удаления
органических примесей, в частности гуминовых кислот, чаще всего
используются следующие буферы: фосфатный


он наиболее способствует
десорбции клеток с почвенных частиц, ТЕ
-
буфер (трис
HCl

и ЭДТА
(
этилендиаминтетроуксусная кислота
)
) наиболее часто используют при
выделении ДНК из бактериальных клеток, буфер ТЕ + поливинил
пиролидоном (
PVPP
) и
SDS
, а так же буфер ТЕ + цетавлон. Последние два
буфера эффективно удаляют органичес
кие вещества, содержащие гумусовые
компоненты

(
Запороженко и др., 2006
)
.

В последнее время широкое применение получило использование
,

так
называемых
,

©китовª

(наборов соответствующих буферов)
для получения
тотального ДНК из
исследуемых субстратов
.
Ниже при
водятся
модифицированные
нами

протоколы
коммерческих
препаратов

для выделения
тотальной
ДНК из
почв,
а так же
из
клеточной биомассы.




9

1.1.
Выделение ДНК
из почвенных образцов
с помощью

Power
Soil

DNA

Kit

(
MO

BIO
)

П
римечание:

все операции производить в рези
новых перчатках

1.

Поместите образец почвы весом
0.25
грамм в 2
-
мл пробирку
Bead

Solution
,
содержащую
лизирующий буфер (
SDS
)
и стеклянные шарики
.


2.

Встряхните

на вортексе

в

течени
е

нескольких минут.

3.

Добавьте 60 мкл
раствор
а

C
1


и несколько раз переверните проби
рку (можно несколько
секунд встряхнуть на вортексе)

4.

Убедитесь
,

что
раствор
не выпал в осадок. Если это все же произошло, нагрейте раствор до
60º и продолжайте нагревать, пока осадок не растворится.

5.

Закрепите пробирки

Bead

Solution

в вортексе
и встряхивайте

10 мин на максимальной
скорости.

6.

Открутите пробирки в течение 30 с. на 10

000
g

при комнатной температуре
.
Внимание:

скорость вращения не должна превышать 10

000
g
,
иначе пробирки могут лопнуть.

Пробирки
в центрифуге не должны касаться друг друга и вращат
ься свободно.

7.

Перенесите супернатант в чистую микроцентрифужную пробирку (входит в набор).
П
римечание:

для образца почвы весом 0.25

грамм получается 400
-
450 мкл супернатанта (в
зависимости от типа почвы). На этом этапе супернатант ещё может содержать почве
нные
частицы.

8.

Добавьте 250 мкл
раствор
а

C
2

и встряхните на вортексе в течение 5 секунд. Инкубируйте 5
минут при 4º.

9.

Открутите пробирки 1 минуту на 10

000
g
.

10.

Перенесите весь супернатант в чистую микроцентрифужную пробирку (входит в набор), не
касаясь осадка
.

11.

Добавьте 200 мкл
раствор
а

C
3

и
встряхните на вортексе

в течение нескольких секунд.
Инкубируйте 5 минут при 4º.

12.

Открутите пробирки 1 минуту на 10

000
g
.

13.

Не касаясь осадка, перенесите супернатант
(
не бол
ее

750 мкл
)

в чистую микроцентрифужную
пробирку (вход
ит в набор).

14.

Добавьте к супернатанту 1.2 мл
раствор
а

C
4

и встряхните на вортексе в течение 5 секунд.

15.

Перенесите примерно 675 мкл супернатанта на колонку с фильтром и открутите 1 минуту на
10

000
g
. Слейте жидкость, добавьте следующую порцию супернатанта и
открутите 1 минуту
на 10

000
g
. Повторяйте, пока весь супернатант не пройдет через фильтр.
П
римечание:

для
каждого образца требуется в сумме три крутки.

16.

Добавьте 500 мкл
раствор
а

C
5

и открутите на 10

000
g

в течение 30 с.

17.

Слейте образовавшуюся жидкость.

18.

С
нова открутите пробирки 1 минуту на 10

000
g
.

19.

Осторожно перенесите колонку с фильтром в чистую микроцентрифужную пробирку (входит
в набор). Проследите, чтобы
раствор
C
5

не попал на колонку.

20.

Добавьте 100 мкл
раствор
а

C
6

без ЭДТА
(
либо стерильную воду для ПЦ
Р
)

в центр белой
мембраны фильтра.

21.

Открутите на 10

000
g

в течение 30 с.

22.

К
олонк
а утилизируется, а в

пробирке находится ДНК, пригодная для дальнейших
экспериментов. Дополнительная обработка или очистка не требуется. Выделенную ДНК
хранить при
-
20º.

Необхо
димое оборудование:

-

микроцентрифуга (до 10

000
g
)

-

дозатор (50
-
500 мкл)

-

вортекс

-

резиновые перчатки



10

1.2.
Выделение ДНК из бактериальной биомассы с помощью

Wizard Genomic DNA Purification Kit


П
римечание:

все операции производить в резиновых перчатка
х

1.

Отцентрифугируйте


1 мл культуральной жидкости в течение 2 минут при 13000
-
16000
xg
*
с
целью осаждения клеток
.


2.

Удалите супернатант.

При работе с гр+ бактериями

переходите к пункту 3, при работе с
отрицательными


к пункту 6.

3.

Ресуспензируйте клетки в 480

мкл 50
mM

EDTA

(
pH
8)
.

4.

Добавьте
120

мкл
Cell

Lysis

Solution

-

литического раствора белка лизоцима (10
mg
/
ml
)

с целью
разрушения клеточной стенки бактерий

и последующего лизиса клеток
.

Для некоторых видов
Staphylococcus

sp
.

См
ешивают 60 мкл лизоцима и 60 мкл
лизостафина
для более эффективного результата, однако большинство клеток грамм
-
положительных
бактерий (таких как
Bacillus

subtilis
,
Micrococcus

luteus
,
Nocardia

sp
,
Rodococcus

rhodochrous
)
лизируются одним лизоцимом.


5.

Инкубируйте образцы при 37
о
С в течение

30
-
60 минут.

Отцентрифугируйте 1 мл
культуральной жидкости в течение 2 минут при 13000
-
16000
xg

и удалите супернатант
.

6.

Добавьте

600
мкл

Nuclei

Lysis

Solution
.
Ресуспензируйте клетки.


7.

Инкубируйте при 80
о
С в течение 5 минут
,

а затем остудите при комнатно
й температуре.

8.

Добавьте 3 мкл
RNase

Solution
, перемешать.

9.

Инкубировать 15
-
60 мин. при 37
о
С. Остудить образцы при комнатной температуре.

10.


Добавьте

200
мкл

Protein Precipitation Solution
к

лизату

клеток
.
Вортекс на высокой скорости

20 мин.

11.


Инкубируйте об
разцы на льду (при 0
о
С) 5 мин.

12.


Отцентрифугируйте при 13000
-
16000
xg

3 мин.

13.


Перенесите супернатант, содержащий ДНК
, в чистую микроцентрифужную пробирку с 600
мкл изопропанола комнатной температуры.

Перемешайте

до однородной массы
.


14.




Отцентрифугируйте

в течение 2 минут при 13000
-
16000
xg


15.




Добавьте 600 мкл 70% этанола комнатной температуры. Перемешайте.

16.


Отцентрифугируйте в течение 2 минут при 13000
-
16000
xg


17.


Удалите этанол и подсушивайте на воздухе в течение 10
-
15 минут.

18.


Добавьте 100 мкл ДНК
Re
hydration

Solution

и инкубируйте при 65
о
С 1 час
, периодически
помешивая, либо 12 часов при комнатной температуре или при 4
о
С.

19.


Выделенные образцы
ДНК хранятся при температуре
-
20
о
С.





*
-

Максимальная скорость работы микроцентрифуги.





11

ВЫДЕЛЕНИ
Е

Д
НК


ИЗ
КЛЕТОК


ПРОКАРИОТ

С ИСПОЛЬЗОВАНИЕМ ОПРЕДЕЛЕННЫХ БУФЕРОВ

Состав буферных растворов, используемых при выделении ДНК

БУФЕР 1

На 50мл:

ЕДТА
pH

8.0 10мМ

(1мл 0.5М ЭДТА)

TrisHCl

pH

8.0 25мМ

(2.5мл 0.5М
TrisHCl
)


БУФЕР 2
(лиз
ис буфер)

SDS

3%


БУФЕР 3
(протонирование ДНК)

Ацетат калия 5М рН 5.0
-
5.5

wash
-
solution

(
на

100 ml
раствора
)
:

2 ml 5M NaCl

1 ml
10 mM
Tris

0.5 ml
0.5 M
ЭДТА


48
ml

этанола (96%)

48.5
ml

wa
ter

MQ

Соотношение объемов буферов при выделении ДНК должно быть одинаково

1.

Ресуспендировать 50 мкл биомассы в 100 мкл буфера
I

2.

Добавить к полученной суспензии 150 мкл буфера
II
.
Все

перемешать.

3.

Добавить 120 мкл р
-
ра лизоцима (10 мг в 1 мл р
-
ра (
v
:
v
; 1:1)
0.05М ЭДТА и 0.1М
TrisHCl
)

4.

Инкубировать суспензию 10
-
20 мин при 68°С или 72°С

5.

Добавить к суспензии 150 мкл буфера
III
, перемешать и встряхивать 2
-
3 мин на вортексе (лучше
перемешивать пипеткой).

6.

Центрифугировать суспензию 7 мин при 14 тыс. об/мин

7.

Осторожн
о отобрать супернатант.

Стадии очистки ДНК:

8.

Добавить к отобранному супернатанту 0,
2

мл смолы
Wizard
-
prep


Promega
“, тщательно
перемешать (15
-
20 раз пипеткой) и нанести смесь на колонку,
предварительно вставленную

в
эпендорф.

9.

Центрифугировать последователь
но все содержимое в режиме 30с. 1тыс.об.
/
мин.

10.

Промыть смесь в колонке 2 мл
wash
-
solution
. Нанесение р
-
р ДНК со смолой на колонку,

вставить
колонку

в эпендорф
продавить смесь
шприцом
через колонку, отсоединить шприц от колонки не
отпуская поршня (чтобы ДНК
не выплеснулась обратно). Вытащить поршень и внести в шприц
2мл
wash
-
solution
, продавить.

11.


Центрифугировать при 13 тыс. об/мин 3 мин.

12.

Поместить колонку в чистый эпендорф. Осторожно нанести 50 мкл
MQ

воду в центр колонки (не
касаясь стенок) и прогреть 5 мин

при температуре от 30 до 65С.

13.

Центрифугировать при 12 тыс об/мин 40 сек.

14.

Удалить колонку из эпендорфа. Фуговать еще раз при 12 тыс об/мин 1 мин и не касаясь стенок
перенести растворенную в
MQ

ДНК в чистый эпе
ндорф (очистка от возможного присутствия
смолы



она остается на стенках).

Хранить эл
л
юированную ДНК при
-

20С.

до 50 мл стер. дистил
H2O



12

Глава
2
.

Амплификация фрагментов генетического
материала

Поскольку извлеченного материала, как правило, недостаточно для
непосредственной идентификации, следующим этапом исследования всег
да
является амплификация фрагментов полученного генетического материала с
использованием полимеразной цепной реакции (ПЦ№) с соответствующим
образом подобранными праймерами

и условиями реакции
. Целью
амплификации является наработка материала в количестве,
достаточном для
последующих экспериментов по идентификации штаммов микроорганизмов,
источников этого материала. Продукты амплификации далее используются для
анализа либо путем прямого секвенирования, либо с помощью электрофореза в
градиенте денатурирующего

агента (DGGE), или для гибридизации in situ
(FISH).

В настоящее время одними из самых распространенных методов в
исследованиях биоразнообразия микробных сообществ являются методы,
основанные на анализе первичных последовательностей нуклеиновых кислот. В
сочетании с ПЦ№
-
анализом, они позволяют наиболее точно проводить
идентификацию микроорганизмов и оценку степени родства между ними.

Первые попытки исследований микробных сообществ с помощью подхода на
основе определения нуклеотидных последовательностей ген
ов р№НК
приходятся на 1985 год. Именно в это время появились работы по анализу
разнообразия сообществ микроорганизмов с помощью секвенирования генов 5
S

р№НК. Эти пионерные исследования привели к интересным результатам,
однако, вследствие небольшой информат
ивности молекулы 5
S

р№НК, а также
невозможности анализа сложных сообществ с помощью данного подхода,
последующее использование 5
S

р№НК не получило широкого распространения.
Позднее, для исследований в области микробной экологии, был предложен
подход на осн
ове использования более крупных молекул: 16
S

р№НК (1500
нуклеотидов) (
Woese
, 1987
) и 23
S

р№НК (3000 нуклеотидов). Анализ полной
или частичной длины молекулы 16
S

р№НК, обладающей достаточной
информацией для надежных филогенетических исследований, получил


13

на
иболее широкое распространение в изучении микробных сообществ (
Amann


al
., 1995
).

Гены р№НК являются наиболее подходящими для идентификации
микроорганизмов в силу ряда особенностей: они универсальны для всех
прокариот, состоят как из консервативных, так
и вариабельных участков,
скорее всего не участвуют в горизонтальном переносе, выполняют важные
функции, находятся в достаточном количестве в клетке и несложно из нее
выделяются. Длина генов 16
S

р№НК не слишком велика и в то же время
достаточна для обеспече
ния статистически достоверной точности анализа, к
тому же нуклеотидные последовательности молекулы 16
S

р№НК широко
представлены в постоянно пополняющейся базе данных (
Prosser
, 2002;
Kirk


al
., 2004
).

На основе анализа генов 16
S

р№НК группой ученых под
р
уководством Вёзе (
Woese
, 1987
) была предложена схема эволюции, согласно
которой все прокариоты разделяются на два домена:
Bacteria

и
Archaea
. В
настоящее время количество основных филумов бактерий с 12, описанных у
Вёзе для культивируемых представителей, р
асширилось до 56 с учетом групп,
не содержащих культивируемые формы (
Нетрусов и др., 2006
). Среди архей,
помимо двух выделенных ранее Вёзе филумов, недавно была выделена еще
одна филогенетическая группа


Korarchaeota
, представленная исключительно
некульти
вируемыми организмами (
Нетрусов и др., 2004
).


2.1.
Полимеразная цепная реа
кция

(
ПЦ№
)

(Polymerase chain reaction (PCR)
)


м
етод, который перевернул
современную молекулярную биологию
,
экспериментальный метод
молекулярной биологии
, позволяющий добиться
значительного увеличения малых концентраций определённых фрагменто
в
нуклеиновой кислоты (
ДНК)

в биологическом материале (пробе).


В начале
1970
-
х годов

норвежскому ученому
Хьеллю Клеппе

из лаборатории
нобелевского лауреата
Хара Гобинды Хораны

п
ришла в голову мысль, что
можно амплифицировать ДНК с помощью пары коротких одноцепочечных
молекул ДНК



синтетических праймеров. Однако в то время эта идея
осталась невостребованной. Полимеразная цепная реакция была вновь открыта


14

в 1983 году
Кэри М
ю
ллисом

(
http
://
elementy
.
ru
/
lib
/430350
;
http
://
www
.
pcr
.
ru
/
bibliogr
/
how
_
pcr
/
how
_
pcr
.
htm
).

‮Этот удивительно простой
метод получения фрагментов ДНК в неограниченном количестве копий был

придуман при необычных обстоятельствах
-

ночью, во время автомобильной
поездки в горах Калифорнии“

(
Телков М.В., 2006
).
Его целью было создание
метод
а, который бы позволил амплифицировать ДНК в ходе многократных
последовательных
удвоений

исходной молекулы ДНК с помощью фермента
ДНК
-
полимераз
ы
.

Через 7 лет после опубликования этой

идеи, в 1993г., М
ю
ллис получил за
проведение реакции амплификации
Нобелевскую преми
ю

в области химии.

Метод основан на многократном избирательном копировании определённого
участка

ДНК

при помощи

ферментов

в искусственных условиях (
in

vitro
)
. При
этом происходит копирование только того участка, который удовлетворяет
заданным условиям, и
только в том случае, если он присутствует в
исследуемом образце. В отличие от амплификации ДНК в живых организмах,
(
репликации)
, с помощью ПЦ№ амплифицируются относительно короткие
участки
ДНК
. В обычном ПЦ№
-
процессе длина копируемых ДНК
-
участков
составляет не более 3000 пар оснований (3 kbp)

(
№ебриков Д.В. и др., 2009
)
.

С
помощью смеси различных полимераз, с использованием добавок и при
определённых условиях длина ПЦ№
-
фрагмента может
достигать 20
-
40 тысяч
пар нуклеотидов. Это всё равно значительно меньше длины
хромосомной

ДНК
эукариотической клетки.
Г
еном человека
, н
апример, состоит примерно из
3млрд пар оснований.

ПЦ№ проводят в амплификаторе

(программируемом термостате)


приборе
,
обеспечивающем периодическое охлаждение и нагревание пробирок, обычно с
точностью не менее 0,1C. Современные амплификаторы позволяют задавать
сложные программы, в том числе с возможностью ©горячего стартаª,
Touchdown ПЦ№ (см. ниже) и последующего хранен
ия амплифицированных
молекул при 4

C.



15

2.2.
Стадии
полимеразной цепной реакции

Денатурация



Первая стадия о
беспечивает разделение нитей ДНК
.

Двухцепочечную ДНК
-
матрицу нагревают до 94

96C (или до 98

C, если используется особенно
термостабильная полимераз
а) на 0,5

2 мин., чтобы цепи ДНК разошлись. Эта
стадия называется
денатурацией
,

так как разрушаются водородные связи
между двум
я цепями ДНК. Иногда перед первым циклом (до добавления
полимеразы) проводят предварительный прогрев реакционной смеси в течение
2

5 мин. для полной денатурации матрицы и праймеров. Такой приём
называется
горячим стартом
, он позволяет снизить количество
не
специфичных продуктов реакции.

Отжиг



Гибридизация

(отжиг) праймеров на матрице
. Проводят при температуре от
45

до
65C
.

Гибридизация
подразумевает
связывание комплементарных цепей
нуклеиновых кислот. Когда цепи разошлись, температуру понижают, чтобы
пра
ймеры могли связаться с одноцепочечной матрицей. Эта стадия называется
отжигом
. Температура отжига зависит от состава праймеров и обычно
выбирается на 4

5С ниже их температуры плавления. Время стадии



0,5

2
мин. Неправильный выбор температуры отжига прив
одит либо к плохому
связыванию праймеров с матрицей (при завышенной температуре), либо к
связыванию в неверном месте и появлению неспецифических продуктов (при
заниженной температуре).

Синтез

(удлинение) цепи
. Проводят при температуре около
72C
.

Происходи
т синтез комплементарных цепей и удваивает число молекул ДНК
мишени
.

ДНК
-
полимераза
реплицирует

матричную цепь, используя праймер в
качестве затравки. Это



стадия
элонгации
. Полимераза начинает синтез


16

второй цепи от 3'
-
конца праймера, который связался с матрицей, и движется
вдоль
неё
. Температура элонгации зависит от полимера
зы. Часто используемые
полимеразы Taq и Pfu наиболее активны при 72

C. Время элонгации зависит
как от типа ДНК
-
полимеразы, так и от длины амплифицируемого фрагмента.
Обычно время элонгации принимают равным одной минуте на каждую тысячу
пар оснований. После

окончания всех циклов часто проводят дополнительную
стадию
финальной элонгации
, чтобы достроить все одноцепочечные фрагменты.
Эта стадия длится 7
-
10 мин.

Для получения достаточного количества копий искомого характеристического
фрагмента ДНК амплификация в
ключает несколько (20
-
40) циклов.

Для проведения ПЦ№ в простейшем случае требуются следующие компоненты

(состав
©
PCR
-
коктейля
ª
)
:



ДНК
-
матрица
, содержащая тот участок ДНК, который требуется
амплифицировать

(
~12
п
l
/100
пl

смеси)
.



Два
праймера
,
комплементарные

противоположным концам разных
цепей требуемого фрагмента
ДНК
(
в концентрации
~
100
pkM
/100
пl

смеси
)
.



Термостабильная
ДНК
-
полимераза



фермент
, который катализирует
реакцию полимеризации ДНК

(
~
500
ед
/
100п
l

смеси
)
.

Полимераза для
использования в ПЦ№ должна сохранять активность при высокой
температуре

(
95
о
С
)

длительное время, по
этому используют ферменты,
выделенные из термофилов



Thermus aquaticus

(Taq
-
полимераза),
Pyrococcus furiosus

(Pfu
-
полимераза),
Pyrococcus woesei

(Pwo
-
полимераза)
и другие

(
Dang

C
,
Jayasena

S
.
D
, 1996
)
.



Дезокси
нуклеозидтрифосфаты

(dATP, dGTP, dCTP, dTTP)



©
кирпичики
ª
,
необходимые для

синтез
а

новой цепи

(
~20
пМ
/100
пl

смеси
)
.



Ионы Mg
2+
, необходимые для работы полимеразы.



17



Буферный раствор
, обеспеч
ивающий условия реакции



рН
,
ионную
силу раствора
.

Tris
-
HCl
,
pH

= 8,0
-
8,8
;
сод
ержит соли, бычий
сывороточный альбумин.
В случае 10
-
и кратного буфера (х10) его
количество в
©
PCR
-
коктейле
ª

не должно превышать 0.1
%

от всего
объема

смеси
.



В приготовлении
©
PCR
-
коктей
л
я
ª

используется исключительно
MQ
-
water

(очищенная от нуклеаз бидистиллированная вода)

2.3.
Праймеры

Праймер (primer)



это короткий фрагмент нуклеиновой кислоты
,

длиной
порядка двадцати оснований
, который служит стартовой точкой при
репликации ДНК
.
Они гибридизуются с ДНК
-
мишенью, которая затем
копируется полимеразой.

Праймеры необходимы
ДНК
-
полимеразам
, так как
ДНК
-
полимеразы могут только наращивать существующую цепь. Полимеразы
начинают репликацию с 3'
-
конца праймера, и создают копию другой цепи.

В
большинстве случаев естествен
ной репликации ДНК, праймером для синтеза
ДНК
,

является короткий фрагмент
№НК

(создаваемый заново). Такой
рибонуклеотидный праймер создается ферментом
праймазой
, и впоследствии

заменяется дезоксирибонуклеотидами полимеразой, выполняющией в норме
функции
р
епарации
.

Многие
лабораторные методы

в биохимии и мол
е
кулярной
биологии, которые предполагают использование ДНК
-
полимеразы, такие, как
секвенирование

или
полимеразная

цепная реакция
, требуют наличие
праймеров.
Специфичность ПЦ№
основана на образовании комплементарных
комплексов между матрицей и
праймерами
. Каждый из праймеров
комплементарен одной из цепей двуцепочечной матрицы и о
граничивает
начало и конец амплифицируемого участка.

После гибридизации матрицы с
праймером (отжиг), последний служит затравкой для ДНК
-
полимеразы при
синтезе комплементарной цепи матрицы
.
Важнейшая характеристика
праймеров



температура плавления (T
m
) ком
плекса праймер
-
матрица. T
m

это
температура, при которой половина ДНК
-
матриц образует комплекс с


18

олигонуклеотидным праймером. Верхний предел температуры плавления
ограничен оптимумом температуры действия полимеразы, активность которой
падает при температура
х выше 80

C.

При выборе праймеров желательно
придерживаться следующих критериев:




GC
-
состав ~ 40

60

%;



близкие
температуры плавления (
T
m
)
праймеров (отличия не более, чем
на 5

C);



отсутствие неспецифических вторичных структур



©
шпилек
ª

и
димеров;



желат
ельно, чтобы на 3‱
-
конце был гуанин или цитозин, поскольку они
образуют три водородные связи с молекулой матрицы, делая
гибридизацию более стабильной.

Если нуклеотидная последовательность матрицы известна частично или
неизвестна вовсе, можно использовать
вырожденные праймеры
,
последовательность которых содержит вырожденные позиции, в которых могут
располагаться любые основания. Например, последовательность праймера
может быть такой:

ATH

, где
Н



А, Т

или
С
.

Основные принципы ПЦ№

1.

Амплификация фрагмента пр
оисходит между двумя праймерами

2.

Амплификацию проводят в течение 30
-
40 циклов

3.

Каждый цикл состоит из смены температурных режимов

4.

В реакции используют термостабильные ДНК
-
полимеразы

5.

За 30 циклов происходит умножение амплифицируемого фрагмента ДНК
в 1 000 00
0 000 раз

6.

Кинетика ПЦ№ характеризуется выходом на ©платоª







19

2.4.
№азновидности ПЦ№



©Вложеннаяª ПЦ№ (
Nested PCR
)



применяется для уменьшения числа
побочных продуктов реакции. Исп
ользуют две пары праймеров и
проводят две последовательные реакции. Вторая пара праймеров
амплифицирует участок ДНК внутри продукта первой реакции.



©Инвертированнаяª ПЦ№ (
Inverse
PCR
)



используется в том случае,
если известен лишь небольшой участок внутри нужной
последовательности. Этот метод особенно полезен, когда нужно
определить соседние последовательности после вставки ДНК в геном.
Для осуществления инвертированной ПЦ№ прово
дят ряд разрезаний ДНК
рестриктазами

с последующим соединением фрагментов (
лигирование
).
В результате известные фрагменты оказываются на обоих концах
неизвестного участка, после чего можно проводить ПЦ№ как обычно.



ПЦ№ с обратной транскрипцией

(
Reverse Transcription PCR, RT
-
PCR
)



используется для амплификации, выделения или идентификации
известной после
довательности из библиотеки №НК. Перед обычной ПЦ№
проводят на матрице
м№НК

синтез одноцепочечной молекулы ДНК с
помощью
ревертазы

и получают одноцепочечную
кДНК
, которая
используется в качестве матрицы для ПЦ№. Этим методом часто
опреде
ляют, где и когда
экспрессируются

данные гены.



Асимметричная ПЦ№ (

PCR
)


проводится тогда, когда нужно
амплифицировать пре
имущественно одну из цепей исходной ДНК.
Используется в некоторых методиках
секвенирования

и
гибридизационного

анализа. ПЦ№ проводится как обычно, за
исключением того, что один из праймеров берется в большом избытке.



Количественная ПЦ№

(
Quantitative PCR, Q
-
PCR
)



используется для
быстрого измерения количества определенной ДНК, кДНК или
№НК в
пробе.



Количественная
ПЦ№ в реальном времени

(Quantitative

real
-
time PCR)



в
этом методе используют флуоресцентно меченые реагенты для точного


20

измерения количества продукта реакции по мере его накопления.
Применение системы детекции результатов ПЦ№ в режиме ©реального
времениª, наряду с ответом на вопрос о налич
ии или отсутствии в
исследуемом образце мишени, позволяет оценить его количество

(
Higuchi
,

al
, 1993
).




Touchdown (Stepdown) ПЦ№ (
Touchdown PCR
)


с помощью этого метода
умен
ьшают влияние неспецифического связывания праймеров на
образование продукта. Первые циклы проводят при температуре выше
температуры отжига, затем каждые несколько циклов температуру
снижают. При определённой температуре система пройдёт через полосу
оптимал
ьной специфичности праймеров к ДНК.



Метод молекулярных колоний (ПЦ№ в геле,
Polony

-

PCR

Colony
)



акриламидный гель

полимеризуют

со всеми компонентами ПЦ№ на
поверхности и проводят ПЦ№. В точках, содержащих анализируемую
ДНК, происходит амплификация с образованием молекулярных колоний.



ПЦ№ с быстрой амплификацией концов
кДНК

(
Rapid

amplification

of

cDNA

ends
,
RACE
-
PCR
)



ПЦ№ длинных фрагментов (
Long
-
range

PCR
)



модификация ПЦ№ для
амплификации протяженных участков ДНК (10 тысяч оснований и
больше). Используют д
ве полимеразы, одна из которых



Taq
-
полимераза с высокой процессивностью (то есть, способная за один
проход синтезировать длинную цепь ДНК), а вторая



ДНК полимераза
с 3'
-
5' эндонуклеазной активностью. Вторая полимераза необходима для
того, чтобы коррект
ировать ошибки, внесенные первой.



RAPD PCR (
Random

Amplification

of

Polymorphic

DNA

PCR
, ПЦ№ со
случайной амплификацией полиморфной ДНК



используется тогда,
когда нужно различить близкие по генетической последовательности
организмы, например, разные сорт
а культурных растений, породы собак
или близкородственные микроорганизмы. В этом методе обычно
используют один праймер небольшого размера (20



25 п.н.). Этот


21

праймер будет частично комплементарен случайным участкам ДНК
исследуемых организмов. Подбирая усл
овия (длину праймера, его состав,
температуру и пр.), удается добиться удовлетворительного отличия
картины ПЦ№ для двух организмов.



RISA

представляет собой анализ полиморфизма длин участков между
генами 16
S

и 23
S

р№НК. Амплификация этих участков, размеры
которых
варьируют от 50 п.н. до более чем 1500 п.н. в зависимости от вида
(
Ranjard


al
., 2000
), приводит к получению фрагментов, которые затем
разделяются в полиакриламидном геле в денатурирующих условиях (
Kirk


al
., 2004
).

2.5.
Факторы, влияющие на т
очность молекулярных исследований

Молекулярно
-
биологические методы, несомненно, открывают новые
возможности в исследовании микробных сообществ, позволяя избежать
проблем, связанных с культивированием микроорганизмов. Тем не менее, эти
методы, в свою очеред
ь, также имеют ряд ограничений.

Полимеразная цепная
реакция (ПЦ№) играет важную роль в молекулярно
-
биологических
исследованиях, однако наряду со своими преимуществами перед методами,
основанными на культивировании, также имеет некоторые ограничения (
Qui


al
., 2001
). Из
-
за разницы во вторичных структурах молекул ДНК, а также
вследствие различной степени сродства праймеров к образцам (
Kirk


al
.,
2004
), в ходе реакции может происходить преимущественная амплификация
генов одних микроорганизмов по отношению
к другим. Есть указания, что
амплификация матрицы ДНК с большим содержанием гуанина и цитозина идет
медленне
е

из
-
за менее эффективного разделения цепей во время стадии
денатурации при ПЦ№ (
Theron

and

, 2000
). Часто бывает затруднена
амплификация гено
в рибосомальной №НК экстремально термофильных архей
по сравнению с бактериями (
Reysenbach


al
., 1992
). Кроме того, минорные
компоненты сообщества могут быть вовсе утеряны в ходе амплификации


22

суммарной ДНК (
Amann


al
., 1995
). Все это, наряду с возможным

образованием химер в ходе ПЦ№ (
Theron

and

Cloete
, 2000
), а также ошибками
полимеразы (
Qiu


al
., 2001
), может приводить к искажению конечных
результатов и затруднениям в их интерпретации (
Theron

and

Cloete
, 2000
).

Некоторые авторы к ограничениям ПЦ№ отно
сят также ее высокую
чувствительность, как к веществам


ингибиторам реакции (
Stackebrandt


al
.,
1999
), так и к загрязнениям, приводящим к ложноположительным или
ложноотрицательным результатам (
Theron

and

, 2000
).

Принцип метода
полимеразной цепной

реакции (ПЦ№)
в настоящее время широко
используется как для научных исследований, так и для диагностики в
практическом здравоохранении и службе госсанэпиднадзора (генотипирование,
диагностика инфекционных заболеваний).

Криминалистика.
ПЦ№ используют для с
равнения так называемых
©генетических отпечатков пальцевª. Необходим образец генетического
материала с места преступления



кровь, слюна, волосы и
т.п. Его сравнивают
с генетическим материалом подозреваемого. Достаточно совсем мало
го
количества ДНК, теорет
ически


одной копии. ДНК расщепляют на
фрагменты, затем амплифицируют с помощью ПЦ№. Фрагменты разделяют с
помощью
ДНК электрофореза
. Полученную картину расположения полос ДНК
и называют
генетическим отпечатком пальцев
.




Кроме того ПЦ№ может использоваться при
установле
нии отцовства

(рис.1
).
№езультаты
электрофореза ДНК
-
фрагментов, амплифицированных
с помощью ПЦ№. №ебенок унаследовал некоторые
особенности генетического аппарата обоих родителей,
что дало новый, уникальный отпечаток.


№ис.
1

(1) Отец. (2) №ебенок. (3) Мат
ь.




23

Медицинская диагностика

ПЦ№ дает возможность существенно ускорить и облегчить диагностику
наследственных и
вирусных

заболеваний. Нужный ген амплифицируют с
помощью
ПЦ№ с использованием соответствующих праймеров, а затем
секвенируют

для определения
мутаций
. Вирусные инфекции можно
обнаруживать сразу после заражения, за недели или месяцы до того, как
проявятся
симптомы

заболевания.

Персонализированная медицина

Известно, что большинство лекарств действуют не на всех пациентов, для
которых они предназначены, а лишь на 30
-
70

% их числа. Кроме того, многие
лекарства оказываются т
оксичными или аллергенными для части пациентов.
Причины этого



отчасти в индивидуальных различиях в восприимчивости и
метаболизме

лек
арств и их производных. Эти различия детерминируются на
генетическом уровне. Например, у одного пациента определенный
цитохром

(белок печени, отвеча
ющий за метаболизм чужеродных веществ) может быть
более активен, у другого



менее. Для того, чтобы определить, какой
разновидностью цитохрома обладает данный пациент, предложено проводить
ПЦ№
-
анализ перед применением лекарства. Такой анализ называют
предв
арительным
генотипированием
.

Друг
ой

метод амплификации

Лигазная цепная реакция (ЛЦ№,
LCR
)
-

м
етод амплификации, включающий
последовательные циклы лигирования (соединения) четырех
олигонуклеотидных зондов, комплементарных цепям ДНК
-
матрицы. Метод
впервые описан в 1989 году. В нем используется способность ДНК
-
лигазы
соединять две пары комплементарны
х олигонуклеотидов после их
гибридизации с последовательностями мишени in vitro. Основными
компонентами ЛЦ№ являются: лигаза, два или четыре специфических праймера


24

и буфер для цепной реакции. В ряде случаев набор может содержать и другие
вспомогательные ко
мпоненты для осуществления лигазной цепной реакции.


2.6.

Амплификация фрагментов
гена 16
S

р№НК

Для проведения полимеразной цепной реакции и дальнейшего
секвенирования ПЦ№
-
фрагментов гена 16
S

р№НК
часто

использ
уется

универсальная праймерная система (
Edwar
ds

U
., 1989
)

Универсальные

праймеры:


341
F
-
GCd

5‱
-
CCTACGGGAGGCAGCAG
-
3‱

907
Re

5‱
-
CCGTCAATTCMTTTGAGTTT
-

3‱

Состав реакционной смеси для ПЦ№

в объеме 25 мкл
:



Праймеры


по 25 пмоль каждого;



10Х буфер
полимеразы
BioTaq

(2 мМ
MgCl
2
; 17 мМ (
NH
4
)
2
S
0
4
; 6 мМ
Трис
-
НС1, рН 8.8)



2,5 мкл

(0,1 часть от всего объема)
;



10

мМ
dNTP



0,5 мкл

(по
1 нМ каждого из четырех
дезокситрифосфатов
)
;



BioTaq

полимераза
(
5Е/мкл)


0,
1
2 мкл;



ДНК
-
матрица


50 нг

(
~3
пl
/25
пl

смеси
)
;



H
2
O



до 25 мкл.


С
приведенным выше

соста
вом смеси р
еакцию провод
ят

по следующей
схеме
:


Первый цикл: 94
о
С


5 мин;

Последующие 20 циклов: 94
о
С


1 мин, 65
о
С


1 мин… 55
о
С


1 мин
(понижение температуры отжига праймеров с
каждым циклом на 0,5
о
С), и 72
о
С


3 мин;

Последние 15 циклов: 94
о
С


1 мин,

55
о
С


1 мин и 72
о
С


3 мин.

После окончания последнего цикла
,

смеси дополнительно выдержива
ют

7
мин при 72
о
С для достройки незавершенных цепей.





25

C

целью получения полноразмерного гена 16
S

применяют

пару
©полнометражны
х
ª праймер
ов
:


11
F

5`
-
AGAGTTTGATCMT
GGCTCAG
-
3`

1492
R

5`
-
TACGGYTACCTTGTTACGACTT
-
3`
,

где М = С или
A
,
Y

= С или Т
.

Использ
уют

следующий температурно
-
временной профиль. Первый
цикл: 94С, 9 мин, 50С, 1 мин и 72С, 2 мин; последующие 30 циклов: 94С, 1
мин, 5С, 1 мин и 72С, 2 мин, окончател
ьная полимеризация
-

7 мин при 72С.

В настоящее время определение последовательностей генов 16
S

р№НК стало
обязательным этапом в идентификации прокариот (
Нетрусов и др., 2004
).
С
появлением методов, основанных на секвенировании генов 16
S

р№НК,
представле
ние об экологии микроорганизмов изменилось кардинальным
образом.
Однако следует отметить, что данный подход не позволяет проводить
оценку разнообразия микроорганизмов, выполняющих определенную
экологическую функцию в экосистеме
,

не
позволяет получать полну
ю
информацию о микробном сообществе, оставляя в тени вопросы, связанные с
филогенией, экологией и разнообразием определенных функциональных групп
микроорганизмов, ответственных за азотфиксацию, нитрификацию,
денитрификацию, окисление метана

и т.д
. Для изуч
ения функциональных
особенностей естественных микробных сообществ широкое распространение
получил подход на осно
ве анализа функциональных генов

(
Prosser
, 2002
).

В
качестве молекулярных маркеров используются гены (или их фрагменты),
кодирующие:
нитрогеназу

(
Задорина и др., 2009
;
Булыгина

и др.
, 2002;
Кравченко

и др.
, 2003
;

Omoregie


al
.
, 200
4
;
Reiter


al
.
,
2003
)
нитритредуктазу
(
Throback

al
., 2007
), нитратредуктазу (
Gregory


al
., 2000
), монооксигеназу
аммиака (
Rotthauwe

al
., 1997
), метанмонооксиг
еназу (
Dedysh

S
.
N
.


al
.
, 200
7
;

Holmes

al
., 1995
), метанолдегидрогеназу (
McDonald
and

Murrell
, 1997
),


26

рибулозо
-
1,5
-
бисфосфат карбоксилазу/оксигеназу (
Tolli

and

King
, 2005
) и
другие белки.

2.7.
Методы определения наличия хитиназного гена группы А у

чистых культур микроорганизмов и в почве

(
ПЦ№ со специфичными праймерами
)



Часто в работах по оценке разнообразия микробных сообществ
исследователи прибегают к использованию различных модификаций ПЦ№,
позволяющих повысить чувствительность метода. Так, с
помощью
nested
-
PCR

становится возможным выявление специфических компонентов сообщества,
часто не обнаруживаемых при обычной ПЦ№ (
Burgmann


al
., 2004
). При этом
сначала проводится амплификация целевых фрагментов с использованием
универсальных праймеров, а

затем реамплификация продукта с помощью видо
-

или группоспецифичных праймерных систем. В частности, можно использовать
праймеры для конкретных микроорганизмов, на чем основана современная
медицинская диагностика.

Так, например, н
аличие хитиназного гена г
руппы А
в

образцах

возможно
оценить

в соответствии с методикой
Nested

PCR

(
Williams
, 2000
) в 2 этапа. На 1
этапе использ
уются

праймеры
GA
1
F

и
GA
1
R
, на 2 этапе
GASQF

и
GASQR
. (см.
таблицу
1
)

№еакцию проводят по следующей схеме: 1 цикл: 94
о
С


5 мин; 35
цикл
ов: 94
о
С


1 мин 60
о
С


10 сек, 72
о
С


1 мин; 1 цикл: 72
о
С


10 мин.

Система используемых

пр
а
ймер
ов
:

Праймер
a

Последовательность (5
‱→
3

)

GA1F

cgtcgacatcgactgggartdbcc

GA1R

acgccggtccagccncknccrta

GASQF

*
cgtcgacatcgactggga

GASQR

acgccggtccagcc

Таблица
1.

Список использованных праймеров


a

-

F
,
forward

primer
,
R
,
reverse

primer
;
прямой

и

обратный

праймеры



27

*
GC

©
хвост
ª,
присоединенный
,
к

5‱
концу

праймера

(
cgcccggggcgcgccccgggcggggcgggggcacgggggg).

Замены

букв

R
, A or g,
Y
, C or T,
S
, C or g,
B
, C or g or
T,
N,
A or C or g or T,
K
, G or T,
D
, A
or g or T.

Глава 3
.

Анализ продуктов амплификации

Анализ продуктов амплификации проводят при помощи электрофореза

-

ПЦ№
-
фрагменты подвергают разделению в агарозном или в
поли
акриламидном
геле в условиях градиента де
натурирующих агентов (
DGGE
) в зависимости от
задачи эксперимента.

3.1.
Электрофорез



это перемещение заряженных частиц в растворе (в
зависимости от знака их суммарного электрического заряда) к аноду или катоду
под действием электрического поля. Поскольку
скорость движения молекул в
электрическом поле зависит от их заряда, формы и размера, то электрофорез
может быть использован для их разделения.

Электрофорез позволяет разделять макромолекулы, различающиеся по
таким важнейшим параметрам, как размеры (или мо
лекулярная масса),
пространственная конфигурация, вторичная структура и электрический заряд,
причем эти параметры могут выступать как порознь, так и в совокупности.

Биологические макромолекулы


белки, нуклеиновые кислоты,
полисахариды и др.


находятся в
водном растворе в виде частиц, несущих
определённый электрический заряд. Заряд макромолекулы определяется
входящими в ее состав группами, способными к электролитической
диссоциации. Степень диссоциации групп зависит от многих факторов, в
частности, от рН с
реды. Общий заряд биологической макромолекулы также
может изменяться при её взаимодействии с ионами или другими молекулами.

Наиболее широкое применение электрофорез получил для анализа и
очистки белков и нуклеиновых кислот, хотя этот метод может быть
испо
льзован и для других заряженных биологических молекул, таких как
сахара, аминокислоты, пептиды, нуклеотиды и др. Для фракционирования


28

белков, нуклеиновых кислот и их фрагментов в настоящее время используют
почти исключительно гель
-
электрофорез. Наиболее ши
роко используются
полиакриламидные (ПААГ) гели и гели агарозы. Варьируя концентрацию
полимера, можно получать гели с очень широким диапазоном размеров пор.

Если
амплифицированные ПЦ№
-
фрагменты

поместить в гель и приложить
постоянное электрическое поле, т
о они будут двигаться по направлению к
аноду, причем молекулы меньшей длины будут
пере
двигаться быстрее
, тогда
как более тяжелые будут оседать ближе к катоду

(рис.

2
)
. Не следует забывать,
что на результаты ПЦ№ сильно влияют температура отжига и
концентра
ции
ионов магния (№ис. 3
а,б)
.



№ис. 2

№езультаты электрофореза
ДНК
-
фрагментов,

ам
плифицированных с помощью
ПЦ№
.



№ис.
3


№езультаты электрофореза
ДНК
-
фрагментов,
амплифицированных с
помощью ПЦ№

при различных
условиях т
емператур отжига

(а) и концентрации ионов
магния (б)
.


а
)
б
)


29

3.1.1.
Приготовление агарозного геля:

Примечание :
Работать только в одноразовых перчатках!

1.

75 мл 1.2% раствора агарозы (0.9 г агарозы + 75 мл
буфера
0.5
xTAE

(
буфер, содержащий Трис,
ацетат и ЭДТА)
)
.
Можно использовать

1% ага
-
розный гель в однократном ТАЕ
-
буфере
.



2.

Поставить гребенки и дать застыть гелю.

Залить в электрофорез 0.5хТАЕ, п
оместить в электрофорез застывший агарозный гель

и
добавить
(ОСТОРОЖНО
!
)
с целью окрашивания
32 мкл
бромист
ого эт
идия


(0.5 мг/мл)

Работа с
бромистым этидием

производится под тягой!

В ка
ждую ячейку геля поместить по 1
μ
l

красителя и 5μ
l

матрицы.

Агарозный э
лектрофорез про
в
од
я
т в условиях
при напряженности поля 6 В/см.

в течении 40 мин.


3.1.2.
Приготовление полиакриа
мидного геля:

Подготовка стекол


1.

Вымыть с моющим средством
стекла для геля
и высушить
их
(или вытереть насухо)

2.

Сполоснуть
MQ

водой и вытереть бумажной салфеткой

3.

Обработать 70% этанолом и вытереть бумажной салфеткой

4.

Сполоснуть
MQ


и вытереть стекла так чтоб
ы не оставалось ворсинок



1.

Вставить между стеклами прокладки

2.

Закрепить их между зажимами (маленькое стекло ближе к вам)

3.

Заклеить дно бумажным скотчем

4.

Отрегулировать расстояние между прокладками с помощью картонки (картонка должна без
усилия вставляться и
выниматься). Перед регулировкой картонку необходимо обработать 70%
раствором этанола.

5.

Установить конструкцию со стеклами в стойку и закрепить ее

6.

Проверить уровень и если нужно отрегулировать его


Г
ел
и


Для 6% полиакриламидного геля:


0%

денатуранта
:


15мл

полиакриламида

(
BioRad

37.5%:1
40%
)

2мл

50хТАЕ


до 100 мл водой (
MQ
)



8
0%

денатуранта
:


33,6 г

мочевины

2мл

50хТАЕ

32 мл

формамида

15мл

полиакриламида(
BioRad

37
.5%:1
40%
)



30


до 100 мл водой (
MQ
)



Все растворы
фильтровать через фильтр!


В
8% гель

вносят 20мл полиакриламида(
BioRad

37.5%:
1 40%
)



Гель для изоляции

(чтобы не подтекало между стеклами)


0% денатурирующий раствор (4°С) 2 мл

10% раствор персульфата аммония
APS
(4°С) 2
0 мкл

TEMED

(
4°С
)


2
мкл

Все быстро перемешать и нанести по 1 мл с каждой стороны пластины, так чтобы смочить прокладки.
Стекла закрываются фольгой и подождать 1 час




Градиентный гель


Объем рас
творов:
1
0
мл 20% (
2,5
мл 80% р
-
ра и
7,5
мл 0% р
-
ра)

1
0
мл 80% р
-
ра


5мл 0% р
-
ра


Перед заливкой геля растворы ставятся на лед
.

В
несение
APS

и ТЕМЕД необходимо проводить при
температуре 4
0
С.


На
10мл

растворов вносят
50мкл
APS

и 6.7мкл ТЕМЕД
(или 100
APS

и
10 ТЕМЕД, но когда гели будут
готовы, обязателен предварительный форез при 100
V

1 час
, лунки промываются
MQ
)

На

5мл
растворов вносят
25мкл
APS

и
5мкл ТЕМЕД




Заливка градиентного геля


1.

Два геля готовят одновременно (20
-
ти и 80%
-
ный по 10мл). Внести в проб
ирки р
-
ры
содержащие акриламид, а затем остальные растворы.

2.

Медленно (не допуская газирования) все перемешать. Наполнить данными растворами
шприцы, выгнать пузыри и закрепить в штативы для приготовления градиентного геля. Шприц с
гелем, в котором содержани
е акриламида (%) больше занимает дальнее положение.

3.

Соединить трубочки и вставить иглу между стеклами.

4.

Залить гель между стеклами, вращая колесо по часовой стрелки с равной скоростью. Вставить
гребенку. Приготовить гель с 0
-
вым % денатуранта (5мл) и пипет
кой долить до края стекол.
Закрыть стекла фольгой и подождать 2 часа

5.

Снять бумажный скотч со дна.

6.

Вытащить гребенку, промыть лунки
MQ


или буфером! (можно уже в камере).




Подготовка гелей для гель
-
электрофореза

(если использовали высокие концентрации
AP
S

и ТЕМЕД)


1.

Промыть ячейки
MQ

водой. Установить стекла с гелем в держатель и всю конструкцию
поместить в камеру с буфером (60ºС).



31

2.

Закрыть крышку камеры. Затем включить питание камеры, включить подогрев

Heat


и
насос. Подождать пока буфер заполнит верхню
ю камеру. Затем включить источник питания и
установить напряжение 70
V

и запуск. Подождать 1 час

3.

Выключить источник питания, насос нагревание и питание камеры. Прежде чем открыть
крышку камеры необходимо подождать 10
-
20 сек.

4.

Вытащить штатив с пластинами. С
лить буфер из верхней камеры

5.

Включить питание камеры, нагрев и насос. Подождать пока буфер заполнит верхнюю камеру

6.

Включит
ь

источник питания
,
выставить необходимое напряжение и запуск. ДГГЕ идет 16
часов.


Для
документ
ации

р
езультат
ов

электрофореза
могут б
ыть
использ
ованы

различные

гель
-
документ
ирующие
системы
.



Глава 4
Оценка мониторинга микробных сообществ
методами, основанными на использовании ПЦР

М
етоды,

основанные на использовании ПЦ№

с целью

мониторинга
микробных сообществ
,

позволяют избежать трудое
мких и дорогостоящих
процедур клонирования и определения последовательностей
амплифицированных фрагментов нуклеиновых кислот. С помощью них
возможно проведение оценки изменений в структуре микробных сообществ,
связанных с временной и пространственной динам
икой. Существует два
принципиальных подхода: 1) Получение целевых продуктов с последующим их
анализом на основе градиентного гель
-
электрофореза (методы
DGGE
,
TGGE
)
или рестриктазной обработки (
ARDRA
,
T
-
RFLP
); 2) Использование ДНК
-
фингерпринтинга на основе
случайных праймеров или праймеров,
комплементарных к повторяющимся структурам генома (
RISA
,
RAPD
).

I

подход

Анализ с помощью градиентного гель
-
электрофореза


Денатурирующий градиентный гель
-
электрофорез (
DGGE
) и
температурный градиентный гель
-
электрофорез
(
TGGE
) являются двумя
сходными методами изучения микробного разнообразия. Первоначально они


32

были развиты для детекции точечных мутаций в последовательностях ДНК
(
Kirk


al
., 2004
). Мюйзер с соавторами (
Muyzer


al
., 1993
) расширили
использование
DGGE
, пр
именив его для исследования микробных сообществ.
DGGE (Denaturation Gradient Gel Electrophoresis)
-

метод денатурирующего
градиентного гель
-
электрофореза
-

основан на зависимости свойств плавления
(или денатурации) небольших двухнитевых молекул ДНК от их н
уклеотидной
последовательности, а точнее
-

от соотношения А
-
Т
-

и G
-
C
-
пар в исследуемых
фрагментах. Объясняется это тем, что G
-
C
-
связь более прочна по сравнению со
связью между нуклеотидами А и Т. Подобные различия в динамике плавления
могут быть выявлены п
утем сравнения подвижности нормальных и мутантных
двухнитевых фрагментов ДНК при их электрофорезе в денатурирующих
условиях. Градиент денатурации достигается разницей температур, различной
концентрацией мочевины или формальдегида в гелях. При этих условиях

одинаковые по величине двухнитевые молекулы ДНК, отличающиеся по
нуклеотидной последовательности, денатурируют по
-
разному.
Все это
позволяет разделять одинаковые по длине, но различающиеся по
нуклеотидному составу, фрагменты под действием градиента химиче
ских
денатурантов в полиакриламидном геле


формамида и мочевины


в
DGGE
,
или под воздействием градиента температуры в
TGGE
. С увеличением степени
плавления происходит снижение подвижности фрагментов, однако при полном
их расплавлении, она резко возрастае
т. Для того чтобы это предотвратить
выделенную из образца почвы ДНК подвергают амплификации с
использованием праймеров, один из которых содержит на своем 5‱
-
конце так
называемый Г
-
Ц ‮зажим“
(

clamp
“)
, состоящий примерно из 40 остатков
гуанина и цитозина. С
помощью методов
DGGE
/
TGGE

теоретически возможно
разделение ПЦ№
-
фрагментов, отличающихся лишь на одну пару оснований. Это
достаточно быстрый, воспроизводимый и эффективный метод оценки
изменений в структуре небольших микробных сообществ (
Kirk


al
., 2004
).

Он
с успехом был применен в исследованиях ризосферных микробных сообществ
(
D
uineveld


al
., 2001; Marschner

al
., 2004
), сообществ водных экосистем


33

(
Diez


al
., 2001
), а также все большее внимание приобретает в работах по
оценке влияния антропогенного

фактора на микрофлору почв (
Ibekwe


al
.,
2001
), включая экологические исследования по оценке риска
биотехнологических растений (
Jung


al
., 2008
).

Анализ на основе рестриктазной обработки ПЦ№
-
фрагментов


Метод анализа полиморфизма длины фрагментов рест
рикции (
RFLP
),
также еще известный как анализ рестрикции амплифицированной
рибосомальной ДНК (
ARDRA
), представляет собой один из инструментов
исследования микробного разнообразия. Выделенная из природного образца
ДНК подвергается амплификации с последующим

расщеплением ПЦ№
-
фрагментов рестриктазами. №азличие в длине фрагментов детектируется с
помощью электрофореза в агарозном или полиакриламидном (не
денатурирующем) геле в случае анализа сообщества.
RFLP
-
профили могут
быть использованы для скрининга клонов и
ли для оценки структуры
бактериального сообщества. Некоторые ограничения метода
RFLP

могут быть
устранены при использовании анализа полиморфизма длин терминальных
фрагментов рестрикции (
T
-
RFLP
). Принцип этого метода такой же, как и в
RFLP

с отличием в том,

что один из праймеров мечен флуоресцентным
красителем. Таким образом, детектируются только меченные терминальные
фрагменты рестрикции. При этом упрощаются профили рестрикции, что
позволяет проводить анализ сложных микробных сообществ (
Kirk


al
., 2004
).


Данные методы применяются в исследованиях самой различной
направленности (
Kirk


al
., 2004
), включая работы по оценке влияния
биотехнологических растений на структуру микробных сообществ почв (
Lukow


al
., 2000; Sessitsch

al
., 2003;
Ikeda


al
., 20
06
).





34

II

подход

Методы
RISA
,
RAPD

и
DAF


RISA

представляет собой анализ полиморфизма длин участков между
генами 16
S

и 23
S

р№НК. Амплификация этих участков, размеры которых
варьируют от 50 п.н. до более чем 1500 п.н. в зависимости от вида (
Ranjard


al
.,

2000
), приводит к получению фрагментов, которые затем разделяются в
полиакриламидном геле в денатурирующих условиях (
Kirk


al
., 2004
).
Высокая вариабельность размеров межгенных участков позволяет
обнаруживать небольшие изменения в генетической структуре

сообщества, а
высокая вариабельность их последовательностей позволяет проводить
идентификацию разделенных в ходе электрофореза полос. Однако банк данных
по последовательностям межгенных участков является не достаточно большим
для эффективного проведения и
дентификации (
Ranjard


al
., 2000
). В
настоящее время существует автоматическая версия
RISA

(
ARISA
), основанная
на проведении ПЦ№ с использованием флуоресцентно
-
меченного прямого
праймера (
Lynch


al
., 2004
). Это более чувствительный метод и более быстры
й
по сравнению с
RISA
, однако, как и все методы, основанные на ПЦ№, ограничен
связанными с этой реакцией недостатками (
Kirk


al
., 2004
). Кроме того, в
случае сложных микробных сообществ, этот метод ограничен в разрешении
большого числа различных ПЦ№
-
фраг
ментов (
Lynch


al
., 2004
).


Для оценки изменений в структуре микробных сообществ используются
также методы
RAPD

(случайно амплифицированная полиморфная ДНК) и
DAF

(фингерпринтинг на основе амплификации ДНК). Оба метода используют
набор коротких случайны
х праймеров (длиной 5
-
10 нуклеотидов), которые
связываются с различными сайтами геномной ДНК, образуя ПЦ№
-
продукты
разной длины. Продукты разделяются в агарозном или акриламидном гелях и
визуализируются с помощью бромистого этидия или окрашивания серебром.

Основной проблемой этих методов является


плохая воспроизводимость
.


азличия в качестве и количестве ДНК
-
матрицы, а также в концентрации MgCl
2



35

и праймеров может привести к появлению различных профилей. Кроме того, с
помощью этих профилей нельзя получить
никакой филогенетической
информации (
Muyzer
, 1999
).

Глава 5 Клонирование

Под процессом к
лонировани
я

понимают как

создание генетически идентичной
копии существующего или существовавшего ранее живого органи
зма путем
бесполого размножения,
так и просто
©вст
раивани
е
ª чужого гена в ДНК
изучаемого организма.


При клонировании гена
в клетки
в
ыделяют следующие этапы
:



Получение изолированного гена.



Введение гена в вектор для переноса в организм (лигирование с
вектором).

Лигирование


процесс соединения двух молеку
л ДНК с
образованием новой химической связи, идет 2 часа при комнатной
температуре.
Состав реакционной среды для лигирования: Буфер ТАЕ,
ПЦ№ фрагмент, Вектор
PGEM
-
T
, Т4 Лигаза.



Перенос вектора с геном в модифицируемый организм.

Соединение
лигата с компете
нтными клетками
E
.
Coli

(
икубир
ование

при 4
0
С)



Преобразование клеток организма.

Высев на твердую среду
LB

и
получение клеток с клонированным геном



Отбор генетически модифицированных организмов (ГМО) и устранение
тех, которые не были успешно модифицированы
.
При необходимости
-

в
ыделение ДНК из клонов и проверка наличия ДНК на агарозном геле

и

д
альнейшие молекулярно
-
биологические анализы (секвенирование)
.


Получение генетически модифицированных организмов (ГМО) связано со
©встраиваниемª чужого гена в ДНК
исс
ледуемого организма
(производят
транспортировку гена, т.е. трансгенизацию) с целью изменения свойств или
параметров последн
его
, например, устойчивость
растений
к засухе, заморозкам,
пестицидам и др.

В основе клонирования лежит процесс г
оризонтальн
ого

(лат
ерального)
перенос
а

генов
.
Горизонтальный перенос впервые был описан в Японии в 1959
году (
Akiba

T
,

all
, 1960
).
При горизонтальном переносе новых генов не
образуется (как то имеет место при
мутациях
), однако осуществляется создание
разных генных сочетаний. Это важно по той причине, что
естественный отбор



36

действует на всю совокупность признаков организма.

Для встраивания гена
используют вирусы, плазмиды (кольцевые ДНК) и др., способные проникнуть в
клетку организма и затем использовать
клеточные ресурсы для создания
множества собственных копий или внедриться в клеточный геном (как и
©выпрыгнутьª из него
)
.
Для успешного установления контакта двух клеток, в
клетке
-
доноре должна присутствовать конъюгативная (половая,
трансмиссивная) плазмид
а. Первой была открыта
F
-
плазмида
:
эписома

(способная встраиваться в бактериальную хромосому), длиной около 100 тыс.
пар оснований. Плазмида несёт гены, кодирующие ряд функций. Одна из
них



образование половых
пилей
, о
твечающих за приклепление к клетке
-
реципиенту.

У прокариот
горизонтальный перенос генов
может
осуществляться в
результате:



-

конъюгации


(от
лат.

conjugatio



соединение
, прямой перенос,
частичное объединение геномов
)


однонаправленный перенос части
генетического материала (
плазмид
, бактериальной хромосомы) при
непосредственном контакте двух
бактериальных

клеток.
К
летка
-
донор в
ходе непосредственного

контакта передаёт клетке
-
реципиенту часть
своего генома (в некоторых случаях весь). Участки ДНК донора могут
обмениваться на
гомологичные

участки ДНК реципиента. Вероятность
такого обмена значима только для бактерий одного вида.

Имеет большое
значение в природе, поскольку способствует обмену полезными
признаками п
ри отсутствии истинного
полового процесса
. Из всех
процессов
гори
зонтального переноса генов

конъюгация позволяет
передавать наибольшее количество генетической информации.



трансформации


(через окружающую среду)
б
актериальная клетка может
поглощать свободно находящуюся в среде ДНК, включая её в свой геном
в случае высо
кой степени гомологии с собственной ДНК.



трансдукци
и


(чере
з фаги или вирусы) в
природных условиях протекает
обмен генетической информацией при помощи умеренных
фагов
.



37

Ниже
приведены некоторые данные о горизонтальном переносе генов у
прокариот, полученные при полногеномном анализе большого числа видов
бактерий и архей

(табл
2
)

(
Koonin
,

all
. 2001)
.

Табл
ица
.
2

Горизонтальный перенос генов у архей и бактерий

Вид

число генов в геноме

перенесенные гены

количество

% в геноме

А№ХЕИ

Archaeoglobus fulgidus


Pyrococcus horikoshii

Aeropyrum pernix



2407

1715

2064

2694


179

77

154

370


8.4

5.0

7.6

14.0

ПАТОГЕННЫЕ БАКТЕ№ИИ

Mycoplasma pneumoniae

Chlamydia trachomatis

Rickettsia prowazekii

Treponema pallidum

Haem
ophilus influenzae

Helicobacter pylori

Mycobacterium tuberculosis



677

894

834

1031

1709

1553

3918


39

36

28

77

96

89

187


5.9

4.3

3.6

8.3

6.2

6.4

5.0

СВОБОДНОЖИВУЩИЕ БАКТЕ№ИИ

Aquifex aeolicus

Thermotoga maritima

Escherichia coli

Pseudomonas aeruginos
a

Bacillus subtilis

Synechocystis sp.



1552

1846

4289

4036

4110

3169


72

198

381

411

537

219*


4.8

11.6

9.6

10.1

14.8

7.5

Эти сведения позволяют сделать ряд обобщений, касающихся закономерностей
латерального генного переноса.

1)

Доля латерально полученны
х генов варьирует у разных видов и
может достигать 10
-
15% от общего числа генов в геноме.

2) Наибольшее количество переносов характерно для свободноживущих
бактерий с широкими экологическими ареалами (почвенные бациллы,
псевдомонады и др.).

2)

Наименьшее числ
о переносов обнаружено у большинства патогенных
бактерий, живущих в узких эконишах; эти переносы, однако, весьма
важны, так как определяют такие признаки как вирулентность и
токсичность.

4) Переносы специфичны, поскольку приобретенный ген


38

обнаруживается, к
ак правило, только в клетках определенного вида или
даже штамма.

5) №еже всего в горизонтальные переносы вовлечены гены
информационных систем (транскрипции, трансляции, репликации),
составляющие базовый геном. Продукты этих генов входят в сложные
белковые
комплексы, где "чужие" белки не встраиваются или не
функционируют. Исключением являются гены, кодирующие аминоацил
-
т№НК
-
синтетазы, что связано с особенностями работы изоакцепторных
транспортных №НК.

6) Чаще всего в горизонтальном переносе участвуют гены оп
ерационных
систем, обслуживающих метаболизм, транспортные пути, механизмы
сигнальной трансдукции. У многих бактерий среди латерально
привнесенных генов большую долю составляют функционально
неизученные гены и гены, не имеющие сходных ортологов в
реципиентн
ом организме.

7) В составе приобретенных сегментов ДНК часто обнаруживаются
профаги, плазмиды, кассеты резистентности, гены белков, участвующих в
процессах сайт
-
специфической и "незаконной" рекомбинации,
обеспечивающей интеграцию "чужих" генов.

Горизонтал
ьный перенос генов является главным источником инноваций,
инструментом быстрого приобретения и возникновения новых генов,
способных радикально изменить свойства клеток, расширить их
адаптационный потенциал.

Изменчивость организмов в результате горизонталь
ной передачи генов
реализуется через различные каналы генетической коммуникации
-

процессы
коньюгации, трансдукции, трансформации, процессы переноса генов в составе
векторов
-

плазмид, вирусов, мобильных элементов. Активный перенос генов
может происходить
в симбиотических, паразитарных или ассоциативных
системах, где осуществляется физический контакт клеток. В сущности,


39

современная генетическая инженерия, использующая разного типа векторы,
базируется на принципах горизонтального переноса генов, хотя еще нед
авно не
было четкого понимания того, что такого рода генная инженерия широко
распространена в природе и играет важную роль в эволюции

(
Турова, 2009
)
. И
только работы в области геномики в последние 10 лет доказали, что
горизонтальный перенос генов был и ост
ается (особенно в мире прокариот)
одним из главных механизмов видообразования. Конечно, в ходе вертикальной
эволюции повышалась степень автономизации организмов, возникали и
совершенствовались барьеры, препятствующие горизонтальным генным
переносам и
©
разм
ыванию
ª

геномов. Это касалось и ограничения контактов
между организмами, механизмов проникновения и транспортировки молекул
ДНК, действия систем рестрикции, разрушающих
©
чужую
ª

ДНК,
репаративных механизмов, обеспечивающих стабильность собственных
геномов.
Поэтому частота горизонтальных переносов была наиболее высокой
на ранних этапах
становления биосферы и снижалась по мере эволюции
высших эукариот с усложнением организации генетического аппарата и
развитием систем репродуктивной изоляции
.

Суммируя предста
вления о роли горизонтального переноса генов в
биологической эволюции можно сделать следующее заключение. Во
-
первых,
геномика не дает информации о том, какие конкретные виды организмов были
первичными донорами генов. Обнаруживаемые в геномах чужеродные ген
ы
могли попасть туда через цепочку промежуточных хозяев. Согласно схеме
Ф.Дулитла, автора термина
©
Латеральная геномика
ª
, на самых ранних этапах
эволюции существовало общее генное
©
коммунальное хозяйство
ª

в
неустоявшихся предковых клетках, между которыми п
роисходил активный
горизонтальный обмен генами. В этот период шло накопление генетической
информации с последующей автономизацией клеток, давших начало отдельным
таксономическим линиям. Картина эволюционных связей в мире предковых
прокариот представляла со
бой не столько ветвящееся дерево, сколько своего
рода мицелий с переплетенной сетью горизонтальных переносов в самых


40

разнообразных и неожиданных направлениях, диктуемых возможностями
физических контактов клеток в общих или перекрывающихся экологических
ниш
ах. Поэтому и геномы прокариот и эукариот мозаичны. Данные геномики
позволяют утверждать, что в ходе эволюции происходили массивные генные
переносы как внутри царств, так и между ними. Многие организмы (в первую
очередь прокариоты) участвовали в горизонтал
ьных переносах как
©
проточные
ª

емкости. Если бы в процессе эволюции энтеробактерия
Escherichia coli

только приобретала, но не теряла гены, то размер ее генома
должен был бы удвоится за 100 млн. лет с тех пор как произошла дивергенция с
близкородственной ба
ктерией
Salmonella
. Этот расчет сделан на основе
применения метода
©
молекулярных часов
ª
. Но размер генома
E.coli

почти не
изменился за это длительное время: геномный анализ выявил не только
приобретение большого числа генов, но и отсутствие многих
©
старых
ª

генов,
обнаруживаемых у сальмонеллы.
©
Захваченные
ª

гены могут сохраниться в
геноме, но могут и подвергнуться элиминации или переносу в клетки другого
организма. Так как в ходе эволюции происходит амелиорация чужих генов, то
по изменению нуклеотидного сост
ава и частоты встречаемости кодонов можно
выявить те гены, которые пришли давно, а какие появились недавно. Баланс
генных потоков, приводящих к приобретению и утрате генов, определяет не
только адаптивную изменчивость организмов, но и поддержание
оптимизир
ованного размера генома. Скорости генных потоков у разных групп
организмов различны и влияют на темпы эволюции геномов. Геномный анализ
позволяет сопоставить время приобретения и утраты определенных генов с
геологическими эпохами, экологическими кризисами
и региональной
динамикой биоты (по крайней мере, в отношении геномов модельных видов
прокариот и протистов). Другое обобщение заключается в том, что не только
сам геном, но и механизмы горизонтального переноса генов являются
объектами эволюционного процесс
а. Эволюционируют каналы генетической
коммуникации, механизмы рекомбинации, участвующие в
©
приживлении
ª

или
©
отторжении
ª

чужих генов. Методы геномики помогают исследовать


41

закономерности эволюции механизмов рекомбинации, их роль в изменчивости
организмов. Е
сли в какие
-
то периоды глобальных геосферных и биосферных
перемен меняется диапазон векторных систем (вирусов, плазмид, мобильных
элементов и т.п.), повышается рекомбинационная активность и частота
горизонтальных переносов генов, то увеличивается и вероятн
ость
приобретения новых генов, обеспечивающих селективные преимущества
клеток. Это не менее важный фактор эволюции, чем изменение темпов
спонтанного или индуцированного мутагенеза. Волны горизонтального
переноса генов могут быть инициированы повышением пло
тности
контактирующих популяций. Там, где нет активных контактов, не будет и
эффективного переноса генов. Особенно результативны такие процессы в
многокомпонентных сообществах, где взаимодействуют различные организмы,
метаболически связанные между собой. Г
еофизические, климатические,
экологические факторы, безусловно, влияют на уровень и диапазон
латерального переноса генов и, тем самым, на темпы и направления
биологической эволюции.

В рамках сальтационной теории неравномерной по темпам эволюции анализ
мех
анизмов и закономерностей горизонтального переноса генов дает новый
ключ к изучению корреляции геосферных изменений и би
ологической
эволюции на планете
(
u/live/liveprint.php?f=doclad&p=shestakov
)
.

С развитием молекулярно
-
биологических методов, геносистематики и
накоплением экспериментальных данных появились и новые проблемы,
связанные главным образом с противоречиями между данными молекулярной
систематик
и и традиционными представлениями, основанными на анализе
фенотипа

(
Турова, 2009
)
. По
-
видимому, существуют объективные
противоречия, обусловленные естественными закономерностями
эволюционных взаимоотношений организмов. Изучение этих закономерностей


являет
ся ключевой проблемой
современной
полифазной систематики.





42

Л
итература


1.

Булыгина Е.С., Кузнецов Б.Б., Марусина А.И., Турова Т.П., Кравченко
И.К., Быкова С.А., Колганова Т.В., Гальченко В.Ф. Изучение
нуклеотидных последовательностей
nifH
генов у представи
телей
метанотрофных бактерий// Микробиология. 2002. Т. 71. № 4. С. 1
-
9.

2.

Задорина Е.В., Слобода Н.В., Булыгина Е.С., Колганова Т.В., Кравченко
И.К., Кузнецов Б.Б. Оценка разнообразия диазотрофов в торфяной
почве методом клонирования гена
nifH
.
//
Микробиолог
ия. 2009. Том
78. №2. С. 252
-
260.

3.

Запороженко Е.В., Слободова Н.В., Булыгина Е.С., Кравченко И.К.,
Кузнецов Б.Б. Экспресс
-
метод выделения ДНК из бактериальных
сообществ различных почв // Микробиология.


2006.


Т.75.


С. 127
-
134.

4.

Кравченко И.К., Дорошенк
о Е.В.

Азотфиксирующая активность
торфяной почвы верхового болота // Микробиология.


2003.


Т. 72.


№ 1.


С. 111

116.

5.

Нетрусов А.И., Бонч
-
Осмоловская Е.А., Горленко В.М., Иванов М.В.,
Каравайко Г.И., Кожевин П.А., Колотилова Н.Н., Котова И.Б., Максимов

В.Н., Ножевникова А.Н., Семенов А.М., Турова Т.П., Юдина Т.Г.

Экология микроорганизмов
.
Под ред. Нетрусова А.И.



М.: Академия,
2004.


272 с.

6.

Ребриков Д.В.,

Саматов Г.А., Трофимов Д.Ю., Семенов П.А., Савилова
А.М., Кофиади И.А., Абрамов Д.Д. ©ПЦР ©в реал
ьном времениªª. Под ред
Д.В. Ребрикова.


М.: БИНОМ. Лаборатория знаний,
2009
.


223 с.: ил.

7.

Телков М.
В., "
Кари
Маллис
,

изобретатель ПЦР
"// ©Химия и жизньª №8,
2006
.

http
://
elementy
.
ru
/
lib
/430350


8.

Турова Т.П. Применение методов геносистематики для решения
вопросов таксономии и изучения биоразнообразия прокариот. Автореф
.
Дисс
.

2009. 86с.

9.

Akiba T, Koyama K, Ishiki Y, Kimura S, Fukushima T. On the mechanism
of the development of multiple
-
drug
-
resistant clones of Shigella. Jpn J
Microbiol. 1960. № 4
.

P.
219
-
27.
PMID 13681921
.



43

10.

Amann R.I., Ludwig W., Schleifer K.
-
Microbiol. Rev.


1995.


V. 59.




1.


P. 143
-
169.

11.

Burgma
nn H., Widmer F., von Sigler W., Zeyer J. New Molecular
Screening Tools for Analysis of Free
-
Living Diazotrophs in Soil //
Appl.
Environ. Microbiol.


2004.


V. 70. № 1.


P. 240
-
247.

12.

Dang C, Jayasena S.D. Oligonucleotide inhibitors of Taq DNA
polymerase
Biol..
1996
. 264
: 268
-
278
.

13.

Dedysh S.N., Belova S.E., Bodelier P.L.E., Smirnova K.V. Khmelenina
V.N., Cidthaisong A., Trotsenko Y.A., Liesack W., Dunfield P.F.
Methylocystis heyeri
sp. nov., a

possessing “signature” fatty acids of type I methanotrophs// Int. J. Syst.
Microbiol. 2007. V 57. P. 472
-
479.

14.

Diez B., Pedros
-
Alio C., Marsh

T.L., Massana R. Application of
Denaturing Gradient Gel Electrophoresis (DG
GE) to Study the Diversity of
Marine Picoeukaryotic Assemblages and Comparison of DGGE with Other
Molecular Techniques // Appl. Environ. Microbiol.



2001.


V. 67.


№ 7.


P. 2942
-
2951.

15.

Duineveld B., Kowalchuk G.A., Keuzer A., van Elsas J.D., van Veen
J.
A. Analysis of Bacterial Communities in the Rhizosphere of
Chrysanthemum via Denaturing Gradient Gel Electrophoresis of PCR
-
Amplified 16S rRNA as Well as DNA Fragments Coding for 16S rRNA //

Appl. Environ. Microbiol.


2001.


V. 67.


№ 1.


P. 172
-
178.

16.

E
characterization of gene coding for 16S ribosomal RNA // Nucl. Acids Res.
1989. V.

17. P.7843
-
7853.


17.

Frostergard A., Courto
is S., Ramisse V., Clerc S., Ber
-
nillon D., Le

Quantification of bias related to
the extraction of DNA directly from soils // Appl. Environ. Microbiol.
1999.
V.
65.
P.
5409
-
5420.



44

18.

Gregory L.G., Karakas
-
Sen A., Richa
rdson D.J., Spiro S. Detection of
genes for membrane
-
bound nitrate reductase in nitrate
-
respiring bacteria


2000.


V. 183.



№ 2.


P. 275
-
279.

19.

Higuchi

l
time monitoring of DNA amplification reactions // Biotechnology.

1993
.
11:1026
-
1030.

20.

Holmes A. J., Costello A., Lidstrom M. E., Murrell J. C. Evidence that
evolutionarily related // FEMS


1995.


V. 132.





3.


P.
203
-
208.

21.

Ibekwe A.M., Papiernik S.K., Gan J., Yates S.R., Yang C.
-
H., Crowley
D.E. Impact of Fumigants on Soil Microbial Communities //
Appl. Environ.
Microbiol.


2001.


V. 67.


№ 7.


P. 3245
-
3257.

22.

Ikeda S
., Omura T., Ytow

N., Komaki H., Minamisawa K., Ezura H.,
Fujimura T. Microbial Community Analysis in the Rhizosphere of a
Transgenic Tomato that Overexpresses 3
-
Hydroxy
-
3
-
Coenzyme A Reductase // Microbes and Environments.


2006b.


V. 21.



№ 4.



P. 261
-
271.

23.

Jung S., Park S., Kim D., Kim Seung Bum.
Denaturing Gradient Gel
Electrophoresis Analysis of Bacterial Community Profiles in the
Rhizosphere of
cry1AC
-
carrying
Brassica rapa

subsp.
pekinensis

// J.
Microbiol.


2008.


V. 46.


№ 1.


P. 12
-
15.

24.



2004.


V. 58.



P. 169
-
188.

25.

Koonin E.V., Makarova K.S., Arvind L. 2001.
Annual Rev.
Microbiol.
v.55: 709
-
42

26.

Lukow T., Dunfield P.F., Liesack W. Use of the T
-
RFLP technique to
assess spatial and temporal changes in the bacterial community structure
within an agricultural soil planted with transgenic and non
-
transgenic


45

potato plants // FEMS

Microbiol. Ecol.


2000.


V. 32.



№ 3.


P. 241

247.

27.

Nannipieri P. Microbial diversity in soil: ecological theories, the contribution
of molecular techniques and the impact of transge
nic plants and transgenic
microorganisms // Biol. Fertil. Soils
.


2004.


V. 40.


P. 363
-
385.

28.

Marschner P., Crowley D., Yang C.H. Development of specific
rhizosphere bacterial communities in relation to plant species, nutrition
and soil type // Plant and

Soil.


2004.


V. 261.



P. 199
-
208.

29.

gene
mxa


1997.



V. 63.



№ 8.


P.
3218
-
3
224.

30.



present
Analysis.


1999.


P. 10.

31.

of nitrogen
-
fixing phyl
otypes in
Lyngbya

sp. and
Microcoleus chthonoplastes

cyanobacterial mats from Guerrero Negro, Baja California, Mexico // Appl.
Environ. Microbiol.


2004.


V. 70.




4.


P. 2119
-
2128.

32.

Prosser J.I. Molecular and functional diversity in soil micro
-
organis
ms // Plant and Soil.


2002.


V. 244.


P. 9
-
17.

33.

Qiu X., Wu L., Huang H., McDonel P.E., Palumbo A.V., Tiedje J.M.,
Zhou J. Evaluation of PCR
-
Generated Chimeras, Mutations, and
-
Based Cloning //
Appl. Environ.
Microbiol.


2001.


V. 67.




2.


P. 880
-
887.

34.

communities using culture
-
independent molecular techniques: application
to soil environment // Res. Microbiol.


2000.


V. 151.



P. 167

177.

35.

Reiter B., Burg
mann H., Burg K., Sessitsch A. Endophytic
nif
H gene


2003.


V. 49.



9.


P. 549

555.



46

36.

Reysenbach A.
-
L., Giver L.J., Wickham G.S., Pace N.R. Differential
Amplification of rRNA Genes by Polymerase C
hain Reaction //
Appl.
Environ. Microbiol.


1992.


V. 58.


№ 10.


P. 3417
-
3418.

37.

Rotthauwe J. H., Witzel K. P., Liesack W. The ammonia
monooxygenase structural gene
amo
A as a functional marker: molecular
fine
-
scale analysis of natural ammonia
-
oxidizing
populations // Appl.
Environ. Microbiol.


1997.


V. 63.





12.


P. 4704
-
4712.

38.

Sessitsch A., Kan F.Y., Pfeifer U. Diversity and community structure
of culturable
Bacillus

spp. populations in the rhizospheres of transgenic
potatoes expressing the lytic p
eptide cecropin B // Appl. Soil Ecol.



2003.


V. 22.




2.


P. 149
-
158.

39.

Stackebrandt E., Pukall R., Ulrichs G., Rheims H. Analysis of 16S
Community Analysis.


1999.


P. 1
-
7.

40.

Scorze
tti G., Fell J.W., Fonseca A., Statzell
-
Tallman A.

Systematics of
transcribed spacer rDNA regions // FEMS Yeast Research. 2002. V. 2. P.
495

517.

41.

Tebbe C.C., Vahjen W. Interference of

humic acid and DNA extraction
bacteria and yeast //
Appl. Environ. Microbiol.



1993.


V. 59.


№ 8.


P.
2657
-
2665.

42.

Mi
crobial Diversity and Communiry Structure in Natural Environments //
Critical Reviews in Microbiology.


2000.


V. 26.


№ 1.


P. 37
-
57.

43.

Throback I.N., Johansson M., Rosenquist M., Pell M., Hansson M.,
Hallin S. Silver (Ag
+
) reduces denitrification and i
nduces enrichment of
novel
nir


2007.


V. 270.


P.
189
-
194.

44.

Tolli J., King G. M. Diversity and structure of bacterial
chemolithotrophic communities in pine forest and agroecosystem soils //
Appl. Environ. Micr
obiol.


2005.


V. 71.


№ 12.


P. 8411
-
8418.



47

45.

van Elsas J.D.,
Duarte G.F., Rosado A.S., Smalla K. Microbiological
. V.32. P.
133
-
154.

46.

Woese C.R. Bacterial Evolution // Microbiological Reviews.



1987.


V. 51.


№ 2.


P. 221
-
271.

47.

http
://
www
.
pcr
.
ru
/
bibliogr
/
how
_
pcr
/
how
_
pcr
.
htm

[pcr.ru] Кэри Б.
Мюллис "
Необычайная история о том, как родилась
полимеразная

цепная реакция

" /
/ В мире науки (Scientific American) Июнь N 6 1990 г.

48.


С.В.Шестаков ©Роль горизонтального переноса генов в эвол
юцииª


Приложенные файлы

  • pdf 18129775
    Размер файла: 1 MB Загрузок: 0

Добавить комментарий